For example, UGA codon is normally a stop codon but in mitochondria it codes for tryptophan amino acid. More than one answer may be correct, or no answers may be correct. Medical Genetics Questions : 15 in total. C. A mature mRNA in the cytoplasm of a cell in a Great Horned Owl. In which tissue is the translated protein the longest? Ans:   Leading strand elongates toward the replication fork. Bicoid (bcd) is a maternal effect gene required for anterior development in fruit flies. It encodes the amino acid methionine. In Genetics, the dominant allele is represented in uppercase (“A”), and its recessive allele is written in lowercase (“a”). The promoter is underlined with a solid line, and the coding region is underlined with a dotted line. Ans: The synthesis of protein from mRNA is called translation. _____________             _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _, promoter                           coding region. 23-What is the function of P site (peptidyl site) of ribosome? Genetics. While we can't answer every question we receive, we do our best to respond. 4) How many pairs of chromosomes are in a human being? atggggggaaatgaattagccagttaaaaacgcctactccagggtctaacctttagtgccaggaaagttcccactcccgcgcttagaacgttggtgagtaggaatacacctatcctagtatttaagggcagaccgtaggagaggtctatgatcacggagaggaaaatcagggccactatggtatagatcgctacctctccaggctcttcctcttcccttatccttctgtttcgaggcaggttgtaagcaaggaagccgccatacactaacaggtccagaactagcggcccccattggcctgacgccgccgcgaagaacggactataaacaactccccaatgaatgtttgacggatagaacagtttagccgccaggtccagtagggttataataacagaaatcgccaacgagaagcccagggctggaaggaagttccaggttcccctggaggacaacttattcgccctgcccctcgcctttcttcctctcttgctgtgagggcggttgagagagctgctgcatcatttgccccaatcctcccgcaccacccattaacaggttaatgggatagtaaggaacaccaaggaacatgttcgtagcagccggatcggatctctgcgccataatctcagccaacctagcccttaaggccaagttgatgtccacgcctattccgctgaattgaattatcctcctcattgtctcatcctctggctctatcctcactaccctgcttaatatcaggttaatccctatctcgttgaggacctgccttaatgcagcggtaaccgcctcgctaaccttatgcattgtggcatatacctccttcacagatatgttgttcagtatttgagatacggcctgatccaatattggtgaagcgtaggccgaaagctcattcaccgtatagaacgggccgttgaactgtacagcctgtaataactttacggggtcggatacttggaaatagtaggccacctggtattggagcggtattagctcagaggtctgactaattcctacgcttctggattcaaatctgctggtactgaaaaatatgacctcagtgagccaaggaacgttcccgccgtaacccagtctcgagaagaagttcgcctacaggactattgggagtgttgaggtcatgggcacctgcatccaaagactaccggttatctgtccttgaatcctcaccaccgcctttt. If this new organism uses ‘codons’ of 6 different ‘bases’ that are grouped into units of 3 ‘nucleotides’, how many different codons are possible? It is linked to 5′ end with the first nucleotide of mRNA. As part of this work, you want to analyze the following nucleotides from the genome of a novel bacterial isolate. SUBJECTIVE QUESTIONS. It is called anticodon. Question3: Is Haemophilia a sex linked disease? Explanation of the question is given of transcription which is the synthesis of RNA from DNA. It is more than enough to code for the 20 amino acids. 13-Differentiate between template strand or the antisense strand and coding strand or the sense strand. It is transcribed from DNA and it travels to the ribosomes and direct precisely which amino acids are assembled into polypeptide. 18-What are terminations or nonsense codes? If no questions are marked for grading, I will grade the first 5. What are the sex chromosomes of a human male, and of a … Change the default setting from ‘Compact’ to ‘Verbose’, and then select ‘TRANSLATE!’. More than one answer may be correct, or no answers may be correct. Ans: It is the site of the ribosome where peptide bonds are formed. Required fields are marked *. Your colleague speculates that ‘this organism has particulate inheritance, proteins made of amino acids, and is membrane bound. Explain. A. The splicing patterns in three different tissues are shown. The area marked X is where the RNA polymerase has bound. The rRNA provide. A. a) Most of the inherited changes in our DNA arise because of exposure to extracellular mutagens, including radiation sources and chemical mutagens. 4. Question2: What is the difference between test cross and back cross? So they are known as nonsense codon. Thus genetic code is a triplet code and the reading occurs continuously. If you used a program to study the translation of the intron sequence in all 6 possible reading frames, would you expect to find a long open reading frame? You can learn everything you need to know about genetics here. These segments are connected later on. Tail is in the form of poly A tail. Under Genetics… ii. The study of genetic. GENETICS QUESTIONS 1. The opposite strand is called coding or sense strand. Ans: During Translocation, the ribosome now moves (translocates) to next code along the mRNA molecule in the. Your email address will not be published. An RNA primer used to provide a 3’OH for DNA polymerase during DNA replication in a Saw-whet owl. While this simple model of eye color genetics can be helpful, eye color is actually influenced by many different genes. Then, go to this site for computerized analysis of nucleotides:  https://web.expasy.org/translate/. You are studying the sequence of nucleotides that make up a long intron in a gene in tilapia, a fish commonly grown in fish farms because they grow rapidly, have a high protein content, are tolerant of diverse growing conditions, and are found to be palatable by many people.